FK826745

Overview
NameFK826745
Unique NameFK826745
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length130
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig6056 contig Csv1_Contig6056:936..1065. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionclone571 Citrus sinensis low-temperature inducible suppression subtractive hybridization (SSH) library Citrus sinensis cDNA clone 571, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FK826745 ID=FK826745|Name=FK826745|organism=Citrus sinensis|type=EST|length=130bp
ACACCAAACTTAAAGAAGAACAAGACCACCTATCAATATCCCAGAGCTGA
ACCCTAATTTAAAACTATACATTAAAATTCTAAATTAACACTACTACTGC
TATTACAGCTTAAAGCTAAACACTAGTCAG
back to top