FK826683

Overview
NameFK826683
Unique NameFK826683
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length472
Alignments
Feature NameTypeLocationAnalysis
FK826683_ssr260 microsatellite FK826683_ssr260:260..275.
FK826683_ssr155 microsatellite FK826683_ssr155:155..166.
Csv1_Contig13688 contig Csv1_Contig13688:325..796. BLAST: Citrus Unigene V1 Contigs to Trembl
Properties
Property NameValue
Genbank descriptionclone281 Citrus sinensis low-temperature inducible suppression subtractive hybridization (SSH) library Citrus sinensis cDNA clone 281, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FK826683 ID=FK826683|Name=FK826683|organism=Citrus sinensis|type=EST|length=472bp
ACGCGGGGAACACAGGGAGGGCGAACACAAGGAGGGCTTGGTGGACAAGA
TCAAGCAGAAGATCCCCGGTGTCGGCGGCGGCGAGGGCGCCGCCCACGGT
GAAGAGAAGAAGAAAAAGAAGAAGGAGAAGAAGAAGCACGAGGACGGACA
CGAGAGCAGCAGCAGCAGTGACAGCGATTAAATTAATTAACTTTTATGTG
ACGCATCAACATCAGCATCATCATCCATCATCTTAGATTTATTCTATAAT
AAAAATTTGGTGTGTGTGTGTGTGTGGTCACAGTAAGAGCTTGCTGCTTT
ATTTTTGGGGTGTCTACTCAAGGTGGTGTTGTGTTTAAATTATTATTGCT
TTTGAGAGACTCTGTTTTTTTTTTATTTATTTTGCCCAGTCAGTGTGTAA
TTTGCCTTTTGTCAATGTGAATTTCCATTATCAATTATATTATGCAAAAA
AAAAAAAAAAAAAAAAAAAAAG
back to top