FK826674

Overview
NameFK826674
Unique NameFK826674
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length191
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig5051 contig Csv1_Contig5051:664..854. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionclone261 Citrus sinensis low-temperature inducible suppression subtractive hybridization (SSH) library Citrus sinensis cDNA clone 261, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FK826674 ID=FK826674|Name=FK826674|organism=Citrus sinensis|type=EST|length=191bp
ACAGAATTCTGATGCTGTGAGCGTGCAGCATCAGAACCCAGATATGAAGA
ACTCAACTACAAAGAATTCAGATGATTCTTCCAAAGTCGATCATCCTCCT
CACTCCGTGCCAAATTGTTCAGAACCTCCACACGATCAGTCAAACTAAAT
TATTACCTTTTTGGTTGTTCTCTTTGTTTTTTGTCACTCGG
back to top