FK826637

Overview
NameFK826637
Unique NameFK826637
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length463
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig1120 contig Csv1_Contig1120:249..711. BLAST: Citrus Unigene V1 Contigs to Trembl
Properties
Property NameValue
Genbank descriptionclone415 Citrus sinensis low-temperature inducible suppression subtractive hybridization (SSH) library Citrus sinensis cDNA clone 415, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FK826637 ID=FK826637|Name=FK826637|organism=Citrus sinensis|type=EST|length=463bp
ACCCTGACTTGAGATCCTTTGAGAGCACCACCGTCGCCACCGAGACCCTC
GTCCTCGGTGTTGCTCCTGTCAAGATGCACTCTGAGGGGTCCGAGATGGG
ATTCGGAGCCGAGGGCGGCTGCAAGTGTGGACCAAACTGCAAGTGCAACC
CTTGTAACTGTTAATGAAGATTACGAGACGTGAACATGCCCCATAATAAA
GCAGCGCTGTGAGGTCGTTTAAATTGTAGTATCAATAAAAAGAACTATTT
GTCTTTTGTGGTTGGCTTTGTTGGATGTCTTTTTATGAGCTTTTGTTTGT
AAAATAAAAACCAGCCATGGCTGCTTCTCCGAATCCTTAACTGGGTTTGT
TGCAGATCCATGGCTAGTTAATTAATCATTAAGTGTATCTGTTACTGCTG
CTTTTCTAATGGGAAGCTTCCTCTCAGACTTTTATCTATATTGTAAAATG
TGTTTGGTTCATG
back to top