FK826635

Overview
NameFK826635
Unique NameFK826635
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length478
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig2731 contig Csv1_Contig2731:241..718. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionclone403 Citrus sinensis low-temperature inducible suppression subtractive hybridization (SSH) library Citrus sinensis cDNA clone 403, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FK826635 ID=FK826635|Name=FK826635|organism=Citrus sinensis|type=EST|length=478bp
ACAAGTATTGATGAGCCTGTATGTGTGGATTGAAGCCAAAACTAACCGGA
CTAACGTATCAGCTTTGATGTCTAAAGAGTTCAAGAGACTCAGTGGTCTT
GGCGTCTTTCTTTTTTGCGTCTTTGCTTTCTTGGAAATGGATCGACCCAG
GATTTGTCTTGTTCTATAGCCTCATTCCAGCGTTTTTTAAATATCTGAAG
CTCCATCGTTGATTGCCTCCTAATCTCAGCTCGCAGATCAACAGGTGCAG
GACCATGTCTCTTTGCTAACTCTTCGCGTTTAGTAGACTGCAAAGACTTT
CTTGTTGGTGGCTGCCCACCCAGAGTCTGTATTCCCTGATGAACCACATA
CTCACTATCGATAATTCCTACATTCTTTGTGCGATCACCCTGCGCACAAT
ATCCGAGTTTCATATCCATTCCCCATCCATGGACAAGATCATTCTGCGGG
AAAAAAAAAAAAAAGAAAAAAAAAAAAG
back to top