FK826631

Overview
NameFK826631
Unique NameFK826631
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length127
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig4626 contig Csv1_Contig4626:764..890. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionclone396 Citrus sinensis low-temperature inducible suppression subtractive hybridization (SSH) library Citrus sinensis cDNA clone 396, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FK826631 ID=FK826631|Name=FK826631|organism=Citrus sinensis|type=EST|length=127bp
ACTTGGGTGGTGATGAGCACTGTCTGTTTGTATCTTCTAAATGGCTCCTC
TAGCTTTACTAGGAACTTTTTGAGTCTTATCCTTCCAAGTTTGCTATCGT
GTATTATTTGTTGAGATATCAGAACTG
back to top