FK826628

Overview
NameFK826628
Unique NameFK826628
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length108
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig538 contig Csv1_Contig538:128..235. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionclone380 Citrus sinensis low-temperature inducible suppression subtractive hybridization (SSH) library Citrus sinensis cDNA clone 380, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FK826628 ID=FK826628|Name=FK826628|organism=Citrus sinensis|type=EST|length=108bp
ACAATTTGTTCAAAGCAGCCATGTCTTTCAGAGGGACAAATGCATCTTCT
GGAATGGGAGTTGCTGATCACAGCAAGAGCACATACCTAGAGTTGCAGAG
GAAGAAAG
back to top