FE659072

Overview
NameFE659072
Unique NameFE659072
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length229
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig2568 contig Csv1_Contig2568:497..725. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Hong Anliu sweet orange SSH librarycdna_library
Properties
Property NameValue
Genbank descriptionC11 Hong Anliu sweet orange SSH library Citrus sinensis cDNA 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FE659072 ID=FE659072|Name=FE659072|organism=Citrus sinensis|type=EST|length=229bp
ACTATTAAAAGTTGTCAATAACAGTTGATATCAATACAACAGCAAAGACT
TAAGAGTGAGTCAAAATTGCTACTGTAACAACATCACTTAAAAAGTTAAA
GCACCGCTAACAGCAAGGGATCTGCTGCTATGCGCCACCACTCCCTAGTG
TGCCCTGACTTTGTGGTTCAACAGCATCTCTCGAAGCTCTGCTGGATCAA
TCTCGACCGCCCGATTCTCCGGCCTGTAG
back to top