FE659067

Overview
NameFE659067
Unique NameFE659067
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length277
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig2392 contig Csv1_Contig2392:550..826. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Hong Anliu sweet orange SSH librarycdna_library
Properties
Property NameValue
Genbank descriptionC6 Hong Anliu sweet orange SSH library Citrus sinensis cDNA 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>FE659067 ID=FE659067|Name=FE659067|organism=Citrus sinensis|type=EST|length=277bp
ACAAATCGCACTTGCATTCGGTGCATCCCAACCTATCTTCGACACCTCGT
GTATCAATTGCATGGACATTAAGAAACCATCTCTCTTCATAGCCTGCAGG
AATTGTAGCAGGATTGCCAATTTCTATACCATAAGGATCTGGAATATGCG
TTGCTGTTCCTCGTGTCTCAGAGCCAAGGCCAAAAAACTGCCCAAGACAA
TTCCTCTGGCATATGCCATCATTTCTCGCTGAAATGTAATCTGATTCACG
AAGAAGTCTGTTGCCATTATACTCTAG
back to top