EY684517

Overview
NameEY684517
Unique NameEY684517
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length847
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
Libraries
Library NameType
Sweet orange bark, greenhouse plantcdna_library
Properties
Property NameValue
Genbank descriptionCS00-C2-003-001-A05-CT.F Sweet orange bark, greenhouse plant Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY684517 ID=EY684517|Name=EY684517|organism=Citrus sinensis|type=EST|length=847bp
TGCAGACCCACGCGTCCGCTAAAGGCACTTGCCCAGATGTTGATAAAGGC
CAGGGATTTTTACATCCGGAGCATAACCGCATGCTCGGACAGTGTTGTAT
TTAGCTCGGCAGGGGGCGTCCCAATAGGCTCAGTCAACACTCTGCCTAGG
AGTTATAGCACCAACTCTTCCAGATCATCAAGGGGTGATGAAGATTTCAG
AGCTTGTTCGAGCTAATTCTATGAAGATTCTTGCCAGTCAAAATCAAATT
GGTCACTTGGAGTTTCATCGGACAAAAAACCAGGAGGCTGCTGCTGGTAA
GAACCATATGCCCAGAAGTAACAGTAGTGCTGCTATTGGGAGGATTGATG
AAGACAAGCCCTGTGACTTCGAAGATGATTTGCAGATGAAGCCTGCTGTC
GTATTCCCGAGAAGCAAAAGCTATGCTGTTTCCAGGAGATCAACTGCCGC
CGTCGTTTCAGCTTAATTAATCAAATACAGTAGTAAGCTGCCGAACCAAA
TGCCACTTTATTTCTTGATTAATTTCTTTAATTTTAATTAACCATATCTT
CTTGCATGTTTCATTTGTGTTTTATAATTCCCAGGACTCTTTCATTATCT
TATGCCAATTTGCATCTTCTTATGGATGTGTATGTAATTTCTCAACGACT
TTGATTCCAATTAGTTAATTTGAGGCATCCCCGATCTTCCCGAAAACAAG
AAAAAACGGCGGCCGGTGCAGAAAAGGCAGGTTGAGCAGGGGCGGATGGG
AGGGAAGAAGCTGGAGAAGGGAAGCAGATGAGTGTGAGGTGGCGAGCGGA
AGAGGGGGAAGCGAGAAGGCCGGGCTGAGGGGGTTGCGCGCTCCACC
back to top