EY659192

Overview
NameEY659192
Unique NameEY659192
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length399
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig1719 contig Csv1_Contig1719:21..419. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionCS00-C1-101-004-D08-CT.F Sweet orange leaf, infected with Xylella fastidiosa (stage 1 of 2) Citrus sinensis cDNA, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>EY659192 ID=EY659192|Name=EY659192|organism=Citrus sinensis|type=EST|length=399bp
CTTCTTTTCTTTTGAGTTTTGAATACGGTTCACTCGAAGCCAGCAGAAAT
CTTTTGCCTTCCTGATTTGAAGATTATGGGAACTCCTTGCGCAGGTTATA
CCGATTGGTCGGAGGGTGGGGCCCCCCCATGGTTTTCACTTATTGCTGAT
GATGAAATTAATGGAAATATTGATCTTCTTGTAGTCCCACAATATGGAAG
AAACCCTGATCACACTGGTTAAGAATATGCAGTATTAGTCTCTTATGTTA
TGTTTAAGAAAATAAAAGTATGGGTACTGTTATTACCCGTCAATTGTACG
ATGGTCTCAGTTTGGTTCAGTTTAACTTGTAAGATCTCTTGATATATACA
AGAGATTCTCTTTGTCTAGCTAAAAAAAAAAAAAAAAAAAAAAAAAAAA
back to top