DR404006

Overview
NameDR404006
Unique NameDR404006
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length450
Alignments
Feature NameTypeLocationAnalysis
DR404006_ssr302 microsatellite DR404006_ssr302:302..311.
DR404006_ssr353 microsatellite DR404006_ssr353:353..364.
Csv1_Contig13751 contig Csv1_Contig13751:1..449. Citrus sinensis Unigene version 1.0 (Csv1)
Libraries
Library NameType
Developing fruit peel at 38 DAFBcdna_library
Properties
Property NameValue
Genbank descriptionCSAH-PNP1246P18 Developing fruit peel at 38 DAFB Citrus sinensis cDNA clone CSAH-PNP1246P18 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DR404006 ID=DR404006|Name=DR404006|organism=Citrus sinensis|type=EST|length=450bp
GGGGAGAGCATAAATGCCTTATGGGCAACTTAATTGCTTTTGTGTTTTGG
NNNNNNNTACCATATGCGAGTAGAGATCTTTTTTTATTACCTTGAAGAAC
ATGGAAACTCCTTGCGCAGGTAATAACAATTGGTTTGAGGGGGTCCCTCA
AATGTGGCAGGCCGGTATTGTTGATGGGGAGAATGTGAACGATAATCTCG
ATTTTCTTGTTGTTCCTCAATATGGAAGAAATCTTGATTACATTGGTTAA
GTGTATGAAATATTATTTTTATTTTTATGTGTAATAAAATAAGAATATGG
ATGTGTGTGTGTTAGTTTCAATATGTACTGTCTCTTTCTAAAACATAAAA
AGTAAATAAATAAAATTATTGTGTGTTAATTTGTTGATTAATAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
back to top