DR403990

Overview
NameDR403990
Unique NameDR403990
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length227
Libraries
Library NameType
Developing fruit peel at 38 DAFBcdna_library
Properties
Property NameValue
Genbank descriptionCSAH-PNP1246O19 Developing fruit peel at 38 DAFB Citrus sinensis cDNA clone CSAH-PNP1246O19 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DR403990 ID=DR403990|Name=DR403990|organism=Citrus sinensis|type=EST|length=227bp
GGGAGATCAGTGTTTCATCTGTTCTGTTGTGATTTTGATCACGTATGTGA
NNNNNNGCCGATCTCCTTTTTTGCAACAGCGAAACCATGGAGTTTCTACA
CTGTTGTTCTTAATTAGTGACCTTGTTTTCCTTTTTTTTCTTTTCTTTTT
TATCACTTTTCCCCCGGTTCAATGAATTAAATCAACACGGATAAATTCAA
AAAAAAAAAAAAAAAAAAAAAAAAAAA
back to top