DR403985

Overview
NameDR403985
Unique NameDR403985
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length486
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig3439 contig Csv1_Contig3439:409..894. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Libraries
Library NameType
Developing fruit peel at 38 DAFBcdna_library
Properties
Property NameValue
Genbank descriptionCSAH-PNP1246O13 Developing fruit peel at 38 DAFB Citrus sinensis cDNA clone CSAH-PNP1246O13 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DR403985 ID=DR403985|Name=DR403985|organism=Citrus sinensis|type=EST|length=486bp
GGGGGCTCAAGTACTTATTTTTTAATATAGTGCACTCGAAGCTAGCAAAT
ATCTTTTCTGACTTGAAGAATATGAAAACTCTTCCTGGCGCAGGTATGAG
CGATCCGTCAGAAGGTTACTTACTCCCCCCTTCCAGTATTGCTGATGATG
ATGTTGGGAATGACAATCTTGATCTTATTGTTATTCCTCAATATGGGAGA
AGTCCTGATTATTATGGGTAAGTGTCTGCAATCTGGATGATGATATATAT
AATTAAATAAAAAGATGGGTACAGTTATTATCTATCAATTATAAGAGTGT
CAATTTAGTTCAGTTCACTTACAAAAATCTCTTATACAAGAGATTATCTT
TGTTTGCGTTCATGTACTTTGTCTTCTTTAATTAATAAATAAAACTATTG
TGTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
back to top