DR403422

Overview
NameDR403422
Unique NameDR403422
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length352
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig4312 contig Csv1_Contig4312:918..1269. Citrus sinensis Unigene version 1.0 (Csv1)
Libraries
Library NameType
Flavedo Maturecdna_library
Properties
Property NameValue
Genbank descriptionCSAF-PNP1244P15 Flavedo Mature Citrus sinensis cDNA clone CSAF-PNP1244P15 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DR403422 ID=DR403422|Name=DR403422|organism=Citrus sinensis|type=EST|length=352bp
GCCGGGGGGGAAAGATTATTGAATCTGAACNNNAAGCCAAAGAAACGACA
CATAATTTGAGGAAAGGCTTATATGCATGGATTGCTATCCTTCTATTTCA
GAGATAACGTCCTTTTGCTTTTTAAGATTTGTGAGCCCTTATCTTCCTGT
TAAATTAAATATTTAACATACAATATACATAATTACTTCCAACGAAAACT
GTTCAGTCTAATCTGATAGATACGGAAATCGCCCATTTTTGTAATTCTGA
TTTTCTTTTTCATTTCAGGATTCCGGATGAACGACTAACAACCTAAATAT
TCCCTTCATATACAAGGAAAAAAGTCTGTGTATCGACCGAAGCAATGACT
AT
back to top