DR403407

Overview
NameDR403407
Unique NameDR403407
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length180
Libraries
Library NameType
Flavedo Maturecdna_library
Properties
Property NameValue
Genbank descriptionCSAF-PNP1244O16 Flavedo Mature Citrus sinensis cDNA clone CSAF-PNP1244O16 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DR403407 ID=DR403407|Name=DR403407|organism=Citrus sinensis|type=EST|length=180bp
GGGGGCCCGGAAGAAGAGAAATCACTTTCGTGCGGTAATTCACTTTGAGA
TATTATCATTTTACCACTCAATTTTCATTTTATTACCAAAATTGTCTGAA
AGTTAAAGATGTGTTTGGTATTATTTTCGGCAAGCTGTTTTTCATCTTGC
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
back to top