CX046725

Overview
NameCX046725
Unique NameCX046725
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length490
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig2383 contig Csv1_Contig2383:321..810. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUCRCS07_9H02_b Parent Washington Navel Orange Thrip-Challenged Flavedo cDNA Library UCRCS07 Citrus sinensis cDNA clone UCRCS07-9H02-P3-1-7.b, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CX046725 ID=CX046725|Name=CX046725|organism=Citrus sinensis|type=EST|length=490bp
TCGAACTTTGATTCCCGTAAGCAGAGATCTTTCTGATTTGAAGAACATGG
AAACCACCTGCGCAGGTAATAACTGGTCAGAGGGTCTTCTGCTTCCTCCG
TTTGGCAGTATTGCTGATGATGATGTCATGAACGACAATCTTGATTTTCT
TAATGTCCCCCAATATGGAAGAAACCCCGACTACATGGGTTAAGTGCAGC
ACTGCTTTTTTTTTTTTCTGTTTTGTTTAATTAAATAAATGATAGGTATA
CTATTACCTATCAATCATGACAATGTTTTAGTATGGTTTAGTTCAACTTA
TAAGATTTCTTGAGACGTACAAGCAATCTTTTTGTTTACTTTTGAGCTAA
GTATTTTCCTGAAAAAGGAAATAAATCAATAAAAGTTATTGTGTGTGTCA
ACATATTGGTTCTATTAGTTTATACACGTCGGTTTTAATTACGATCTCTC
TTCCTAAATGTTGTACTTTTTTTTGAAATAAACTCAACCT
back to top