DN617288

Overview
NameDN617288
Unique NameDN617288
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length539
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig6366 contig Csv1_Contig6366:127..665. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUCRCS11_01A04_f Parent Washington Navel Orange Scale-Infested Rind cDNA Library UCRCS11 Citrus sinensis cDNA clone CS_WEd0001A04, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DN617288 ID=DN617288|Name=DN617288|organism=Citrus sinensis|type=EST|length=539bp
AAATTTCGTAAAGGGTTGGACACTGACAAGTCAACTTAACATGTTCCATT
GTTACACAGGATAAGAAAATTTAAAAAATTTTAAAAACAAGGGAACCTAC
TTAACATAGTGATACACAGGACTTAGTAGACCAGTTGCTTTGAATTGGGC
AATTGCCAACTTCTGAGACCAAAGAATACCTAATATCTCATGAGTGTTGC
GGCCTCAAGAATTTTAGAGCACTATGAAAGGAAAGCATGTTTACGCAATA
GCATATTTGATGGTCTCCAACTCTTTCGGCCGCCACATGGACTTTTCGAC
GCAAAGCAAGCCCTCCTTGTCCTTGGAGTAAGTCATCCGAACCTCCCACT
GCATACCTTTCACCATGCTCTCTAACTCATTAATTGTCTCAACATCATCA
CGTACAATTAGCTTTCCTTCTGGCCTGAGGATCCGATCAACCTCAGCAAC
CACAGCTACTAGATTACACCTCTTTTTAATCTTGGAGAAAAGATGGTCTG
CATGGAGGAGATCATAAGTTCGAGGGTAGGTGCTAAATG
back to top