DC900441

Overview
NameDC900441
Unique NameDC900441
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length208
Libraries
Library NameType
VSScdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig2440 contig Csv1_Contig2440:740..947. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionDC900441 VSS Citrus sinensis cDNA clone VSSH021 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900441 ID=DC900441|Name=DC900441|organism=Citrus sinensis|type=EST|length=208bp
GGCACGAGCTTGANTGTTCCCCCTGAGAGCACTAGGTCTAATGGTGCTGA
AATTATTGATGTGAATGTNCGGCCTATTGTGGATGGAGGCTTTCAGGAGC
CTAGCAACTCCTTCAGTGTGAAGGAGCCAGCAAAGCCATGGGTTGAACAG
CCTAAAAAGGAGCAGGAGATGAATGTNCCTCTAAATAATAGCTTGCTGGT
TGGGCACG
back to top