DC900434

Overview
NameDC900434
Unique NameDC900434
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length231
Libraries
Library NameType
VSScdna_library
Alignments
Feature NameTypeLocationAnalysis
DC900434_ssr145 microsatellite DC900434_ssr145:145..156.
Csv1_Contig1028 contig Csv1_Contig1028:116..346. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionDC900434 VSS Citrus sinensis cDNA clone VSSG023 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900434 ID=DC900434|Name=DC900434|organism=Citrus sinensis|type=EST|length=231bp
GGCACGAGGGAAAACATATGGCAACCGATGATAACAAGGTTGCAGGTTCT
AAGCCATCTAATTCTAAGTGGTTCTTTNCTAACAAGGGTCATGGGTTAAG
CNTTCATCGTCGTCGATCAAAGTCAAAGTNTAGCTCTTCATCGTCAACAA
CAACAACATTAAGCTCTCCAAACTCCTCCTTGTNTGCNTGCNAACCCAAA
AAGNTCACAAAAGAAGATGAGTTGAAGCAAG
back to top