DC900433

Overview
NameDC900433
Unique NameDC900433
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length228
Libraries
Library NameType
VSScdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig10290 contig Csv1_Contig10290:325..552. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionDC900433 VSS Citrus sinensis cDNA clone VSSG022 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900433 ID=DC900433|Name=DC900433|organism=Citrus sinensis|type=EST|length=228bp
GGCACGAGCAACACTCTCCTTCCTTATACTTGCTTTGGCCACAAAACCTC
ANTTGGGCGCCTCAGAATCTGAACCTATCTTAGATGTCTATGGCAACCAG
GTGGACTCCAGCCACAGGTATTATCTTGTNTCAGCACTCTGGGGAGTTAA
AACCGGCGGTGGAATTAGCGCGGACAAAGGCAAAANTGGACAGTGTCCAA
CGGATGTTATCCAATTAAGTCCTAAGGA
back to top