DC900432

Overview
NameDC900432
Unique NameDC900432
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length285
Libraries
Library NameType
VSScdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionDC900432 VSS Citrus sinensis cDNA clone VSSG019 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900432 ID=DC900432|Name=DC900432|organism=Citrus sinensis|type=EST|length=285bp
GGCACGAGCAGTGAGCAAGCAACAGACATGCTGGAAGTGGATGGCAAGGC
TTCGTGTGAAGGGCAAACAACTTGNTGCATTGTGAACCTTCAACTGGAGA
TGAACGGCTACTTGCAAACATACAATTNTNCTGCGATCACGNTGACTGTA
GCATTATACAACCCGGGGGCGTGTGTTACGAGCCTAACAACAATTACTCA
CATGCTTCANTTGTCATGCATCTNTNCTACAGGGCCAATAACANGCTACC
CCACACCTGTNATTTCATGCAGAGTGGTCTGATTA
back to top