DC900431

Overview
NameDC900431
Unique NameDC900431
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length301
Libraries
Library NameType
VSScdna_library
Alignments
Feature NameTypeLocationAnalysis
DC900431_ssr204 microsatellite DC900431_ssr204:204..221.
Csv1_Contig6901 contig Csv1_Contig6901:90..390. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionDC900431 VSS Citrus sinensis cDNA clone VSSG018 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900431 ID=DC900431|Name=DC900431|organism=Citrus sinensis|type=EST|length=301bp
GGCACGAGGCTTATCCTTATCCTGCTCAAGGATATTATCAAGGACCCCCA
GTNATGGCACCTCCTCAGTATGCAGCAGCTCCACCACCCAGGAGAGAGCC
TGGTTTCCTTNAGGGATGTTTGGCTGCTTTATGTTGCTGCTGCCTTCTTG
ACGAGTGCTGCTGCNATCCCTCTATCATCTTTATCGACTAGTTAATGATG
ATGATAATAATAATAATAATAATCCGGTAATTTCAGTGTTAGTAATTTCA
CCNACTTTATGTCTATTGGAATATATATAGTGTCAATGATGNACTTGCTT
G
back to top