DC900424

Overview
NameDC900424
Unique NameDC900424
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length331
Libraries
Library NameType
VSScdna_library
Properties
Property NameValue
Genbank descriptionDC900424 VSS Citrus sinensis cDNA clone VSSE040 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900424 ID=DC900424|Name=DC900424|organism=Citrus sinensis|type=EST|length=331bp
GGCACGAGGAGAATGCATATCCCACTCTGAACATACTTCTGGTCAGGTTG
AGGCTGGAACCGAGCTGAGGGGTTCAAACCTTTCAGAAGCCAAGGATTCT
GACAAAATGGATTACAGGAAAGATTCTGATAAAAACGTGCTTTCAACTCC
TGTAGTGGTAGTCCTCCCACAGGGGCAGTCATCAGATGTTGGGGAGATGA
TGGATGAAACTATGAATACCACACTTGGAAAGAGTAGGTCCAGGAAGAAG
AAAGTGTTTGACTTGCCTCGTCGNNTTCAAACGACTTTCTGGGTTNCACT
TGATCCACACCAGACTAAAACTAGTATCGAG
back to top