DC900419

Overview
NameDC900419
Unique NameDC900419
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length177
Libraries
Library NameType
VSScdna_library
Properties
Property NameValue
Genbank descriptionDC900419 VSS Citrus sinensis cDNA clone VSSB004 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900419 ID=DC900419|Name=DC900419|organism=Citrus sinensis|type=EST|length=177bp
GGCAGGCAGCACATTTGNTCTTCTCAGCTGTGTCCACAATTGCTCATACA
GGTGGAGTTCCCTTAGTAAGAGGGACCTCGAGAGGGGCANAGGTAATATG
CTTCATCACNGGTNTACAGTGNGGTGGTTCACTTCATNAGTTGATGTGAC
ATTAGACGGCAATGAGAATTTATGCAG
back to top