DC900416

Overview
NameDC900416
Unique NameDC900416
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length414
Libraries
Library NameType
VSScdna_library
Alignments
Feature NameTypeLocationAnalysis
DC900416_ssr378 microsatellite DC900416_ssr378:378..389.
Properties
Property NameValue
Genbank descriptionDC900416 VSS Citrus sinensis cDNA clone VSSA008 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900416 ID=DC900416|Name=DC900416|organism=Citrus sinensis|type=EST|length=414bp
CCAAAATAAACCNAAGGGCCTTTNACCCAAAAAACANACCCCTCCCCAGA
GTGGACCAAAAGGTATCCCCCTTTGTCTGAACTGGGCAACATGACCCGAG
CCTTTCGCCTCTTTCTCCGAGAAGNAAATGTCCTTCAAAGACTTATTAGG
NACAATGATAAGNCCAATACTTGANTGAACCACTCGAAGGGTTCNCNTCT
TGAAATTGGCAGCAAGTCTTTTCTTCCTCTCAGCCGCTGTTTCAAACCTG
TAGTAAGATGATATCACATGAACCNCGAATGGTTGAGATATGGGGAAACT
CTANTTTTCTTTTAGGGCATGCATAAGGACGATATTTGCGTGAAAGGCTG
TGAANTCGACCATCATCTTCATATTCTTCATCATCATCANAAATTTGTGT
ACTATTACTCGTGC
back to top