DC900410

Overview
NameDC900410
Unique NameDC900410
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length329
Libraries
Library NameType
VSScdna_library
Alignments
Feature NameTypeLocationAnalysis
DC900410_ssr241 microsatellite DC900410_ssr241:241..255.
Csv1_Contig8957 contig Csv1_Contig8957:16..344. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionDC900410 VSS Citrus sinensis cDNA clone VS28987 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900410 ID=DC900410|Name=DC900410|organism=Citrus sinensis|type=EST|length=329bp
CTTCAGTTTCCCATCCTTGGAAGCTTTAATCGTGGAGAATTGCCCCAAGT
TGAATACTTTCTCTGCAGGAGTTTTGAAGACACCAAGGTTACGAGCAGTT
CAAAATTGGGAACTGGGTGAAGACTTTTGGGCAGGTGACGTCAATACAAC
ACTTCAACACTTGAATGAAAAAGTGGCTAAACGTCGCATGACAGAGGTTG
AATACGATTCTGAGACGTCGATGTCAGAGGAAAATGAGGCGGAGGAGGAG
GAGGAAAATGTTAGGGGGTGACCCATCGGCTGAACGTCCCATGACGTTAT
CGCATACTGATGAGGATGAAGATGAGGAG
back to top