DC900409

Overview
NameDC900409
Unique NameDC900409
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length342
Libraries
Library NameType
VSScdna_library
Alignments
Feature NameTypeLocationAnalysis
DC900409_ssr244 microsatellite DC900409_ssr244:244..259.
Properties
Property NameValue
Genbank descriptionDC900409 VSS Citrus sinensis cDNA clone VS28986 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900409 ID=DC900409|Name=DC900409|organism=Citrus sinensis|type=EST|length=342bp
CGGAACCCCTCTTAATATCTCATCTTTCTCCACTGCAAGACCCTGTTATT
GCCTTAGAACCAATGTCCAAAAGTGATCCAATAGAATTTTCTCCATTAAT
TTTTTTAATTTTAAAATAAAAACCAATAACCTTGGCAACCAGTTCAGTGA
GCCTGTTTGGGGGAGCTTCAGCATTTAAAGGCGTCATTGTGGCTGAAGCA
ACAGCATTTGCAGCCTACAAAAAATTATCAATTTTTTTTTTCAGTGTGTG
TGTGTGTGTACACTAAAGATTTCGATAAAAGGAGACAAGGGGGTTGCCTG
AGAGAGATTGTATTGTTTATGGTTATGTAATTGGATTTATAG
back to top