DC900400

Overview
NameDC900400
Unique NameDC900400
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length442
Libraries
Library NameType
VSScdna_library
Properties
Property NameValue
Genbank descriptionDC900400 VSS Citrus sinensis cDNA clone VS28975 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900400 ID=DC900400|Name=DC900400|organism=Citrus sinensis|type=EST|length=442bp
CTCTGAGGTTGGCTTTTGTCTCGGGCGGTGTCCGGAAGAATAGAGAGTTG
ACAATGGGACCTGGTGGACCAGGAGGACCAGGAGGACCAGGAGGCCCTGG
CGGACCGTGGGGTCCTCGCCCTGGAGGTCCTGGTTTCTTTCCTGGACTTG
GTGGGTGTGCAGACGGTATGTGCAGCATGATCTCCTCTTGCTTATACTGT
CTCTGCTGCTGTTGGTTGCTACAAGATTGCTTCGGTGGAGCCCGTGGCCC
CTACGGTCCACCTGGCGGCCCCCCGCCATTCTGATTTCTTTACCGTCGGT
CGGAGTGTTGATATTTTTCTGCGGTTGTTTGCTGCGAGATTTTCTTTCGG
GGACCCCATGGCACCCTTCACCACTCTGATGGCGTGTTGTTATTTTTTCT
GCCTACGCAAGCTCTTGCCAACTTATGTAGTTGCTCTTTCAG
back to top