DC900394

Overview
NameDC900394
Unique NameDC900394
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length1134
Libraries
Library NameType
VSScdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig5662 contig Csv1_Contig5662:1..1134. BLAST: Citrus Unigene V1 Contigs to Populus V2 proteins
Properties
Property NameValue
Genbank descriptionDC900394 VSS Citrus sinensis cDNA clone VS28967 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900394 ID=DC900394|Name=DC900394|organism=Citrus sinensis|type=EST|length=1134bp
TTTTATTTATTAATTAAAGAAGACAAAGTACATGAACGCAAACAAAGATA
ATCTCTTGTATAAGAGATTTTTGTAAGTGAACTGAACTAAATTGACACTC
TTATAATTGATAGATAATAACTGTACCCATCTTTTTATTTAATTATATAT
ATCATCATCCAGATTGCAGACACTTACCCATAATAATCAGGATTTCTCCC
ATATTGAGGAATAACAATAAGATCAAGATTGTCATTCCCAACATCATCAT
CAGCAATACTGGAAGGGGGGAGTAAGTAACCTTCTGACGGATCGCTCATA
CCTGCGCCAGGAAGAGTTTTCATATTCTTCAAGTCAGCTCGTGCCGAATT
CGGCACGAGGGTTCTTGAGAAGACGGCACCAATACTTGACAGCCAACAAG
CCCTCGACTTCGACAATGGGCCAAAATTCTGTAAAGGCTCAGCAGAAACC
AATCCCAAGTAGGAAAATGGCAAAAGAAAGGAATTACGGCAGAAAGGCAG
CTGCTTTGTGTCGCCCACCTTTAGGTTTTGATCTAAATAAAAAGGGAAAG
GCTTATAATGAAAAGGAAGCAACTTTGCGAAACCCCATTCCTGTTTTTGA
TTTGAACCAGAAGCTGAAGGCTTACAATGGAAAGGAATCAACTTCGCTAC
ATTCCTTGCCAGTTCTTGATCTAAACCAGAAGGAAAGGGTTTACAGTCGA
AAGGATGCTGCCATACAAAACATGACTCCAGTTTTTGACTTAAACCAGAT
ATCGAGAGAGGAGGAAGAATTCAATAGCGAGCCATGGAGGGTAGAGGAAT
CAAATAAAAGTTCAGTCAGAGGTGGAAGTGAGGAGCAGCTTAATGACATG
AAGTTATTAGTTTGTAGGAATATCGGAAACGGGGCAAATCGGTCAGGGAA
GAGGAAGATTTCATGGCAAGATCAGGTTGCCTTGAGAGTTTAAGTTCTTA
GTTGTATTGAAATTTAAGAGATTATATTTTGGTAAGCTTACCTTGTCTGC
TTTGTTGTGTCTACTTATAGTTCTTCATACTATTTTATTTACCTTCTCAT
TGTAAAGTACAAGACAGTAGTTTATATATTAAATACATAAATGGAATGGA
TGAATTGGTGGTTAGAACACATTCTCCTGTTTTT
back to top