DC900377

Overview
NameDC900377
Unique NameDC900377
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length345
Libraries
Library NameType
VSScdna_library
Alignments
Feature NameTypeLocationAnalysis
DC900377_ssr214 microsatellite DC900377_ssr214:214..225.
DC900377_ssr310 microsatellite DC900377_ssr310:310..321.
Csv1_Contig4239 contig Csv1_Contig4239:1..345. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionDC900377 VSS Citrus sinensis cDNA clone VS28947 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900377 ID=DC900377|Name=DC900377|organism=Citrus sinensis|type=EST|length=345bp
GCATTACGGTTCACTAGAAGCTTTGAAGAATATGGAATCTCTTTGCGAAG
GTAAGAATGATTGGTTGGAGGGTCTCCAATTTCCACCATGTGGCAGTATC
GTTGATGATGAAATTGTGAATGAAAGCCTTGATCTTCTTGTTCCTCCTCA
ATATGGAAGAAATTCCAACCACACTGGTTAAGCGCATGAAGTCTCACTTT
TTTATATTATGTTTAAATAAATAAAATGATGGGTACTGCTATAAAATCTC
TTGAGATATTCAAGAGATTTTATTTGTTTATTTACATGTACCGCGTTTTC
TTAAAAATAAAATAAATAAATAAAATCTGTTGTGTGCCAATGTTT
back to top