DC900374

Overview
NameDC900374
Unique NameDC900374
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length803
Libraries
Library NameType
VSScdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig1112 contig Csv1_Contig1112:866..1667. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionDC900374 VSS Citrus sinensis cDNA clone VS28944 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900374 ID=DC900374|Name=DC900374|organism=Citrus sinensis|type=EST|length=803bp
ATGCACCACCTGAGAACTCTCCACCTTCCTCTATAATAAANAGATGATAT
GGATGATAAGTTCTTCAATCCAATATGAATACCAGGACTACTGCTGAAAT
CTCATTAGAAGCANCTGGGGGATCAACTAGCTATGAAGCAGATTTTCAGA
ACACAGAGAACATCCACGACAATCTGTTTACTCAAAATTTACATAGCCGG
GCCAGCCATGGGACACGCACTAGTACCACTCACAGTGCTATAAGCAAGCA
CCTCGAATGGTGAAGAGCTAGAAATGCTCCTGGAGGCGTACTTTGTGCAA
ATTGATGGTACACTGAACAAGCTATCTACGCTGAGGGAGTACGTTGATGA
TACAGAGGACTACATTAACATAATGCTGGATGACAAACAGAATCATCTTC
TGCAAATGGGGGTCATGCTAACGACAGCAACCCTTGTGGTGAGTGCATTT
GTTGTTGTGGCTGGTATTTTCGGGATGAATATCAACATCGAGCTGTTCGA
TGAGCATAAATCAGGGATGCAAGAGTTTCTCTGGACTGTTGGTGGCGGCG
CCACTGGCAGCATATTCCTATATGTTGTTGCCATTGCCTGGTGCAAGCAC
AAACGTTTGCTGGAGTAATATAATCCTGCTGTGTATCAGAAAAGAAGCAA
TTGATTTCAGGAGCTGTTGTGTCGATGGATTTACTATGTACAAACATAAA
CGCACCCTTTGATAAGCTGGAGCATGCATCCTGTTTTTTGTGAATACTAT
GAGATATGCTTCGAGTGCAGGGAACATTAATATTTAATATTTAATACACT
TTC
back to top