DC900372

Overview
NameDC900372
Unique NameDC900372
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length619
Libraries
Library NameType
VSScdna_library
Alignments
Feature NameTypeLocationAnalysis
DC900372_ssr430 microsatellite DC900372_ssr430:430..441.
Properties
Property NameValue
Genbank descriptionDC900372 VSS Citrus sinensis cDNA clone VS28942 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900372 ID=DC900372|Name=DC900372|organism=Citrus sinensis|type=EST|length=619bp
TATGCTCCCCCCCAAAATTTCCCCCCCCTCANAAAAGTACCCCCCTCCGC
AAAATTATCCACCTCAACAAAATTTTGGCCCTCCAGGACAAGGACAAAGA
GAGGGGCCCATGCTAGTGAACAATAGAGATAATGCGGCTGGTGGAAGAGA
CTCTTATCAGGCAGAAGGAAGAGGTCCAATGCCTTCACATCAGGGCAATT
ACAACCAAGCGGGGCAGGGAAATTATAATCTTCCACAAGGAGACCAGAGT
GGTTATGGGCGCGGCAGTTTTTCTGGTGCTTCCTATGGGGGATCTTATGG
ACAAGGAACAAGTTCTAGTTATGGACAGAGTTACCATGGGCAAGGAGAGG
ATCAAAGATTTTCACAAGCGGATCAGGGAAACATACAAGGTAAAATATCA
GGATAATTGGTTCTCTGGGATGACGAGTTGGGAGGGAGGGACCTGAAAAG
TACTTAGGAGTTGCTTTTTCTCTTGTTCATGGGTTGTAGGATAGTACATT
TTAAAATATGCCGTGGTAAATATGTTGACAGACTAAGTTGTTTTCCTGTC
TGTTTGAGGATTGGAAATGGATTCTTGCTTCGCATTGTTAAGTACTTTGG
CCATAAATATAACGGTTTA
back to top