DC900370

Overview
NameDC900370
Unique NameDC900370
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length459
Libraries
Library NameType
VSScdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig10405 contig Csv1_Contig10405:107..565. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionDC900370 VSS Citrus sinensis cDNA clone VS28940 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900370 ID=DC900370|Name=DC900370|organism=Citrus sinensis|type=EST|length=459bp
GTGTTGATGGGATGATCAGTGTGATAGCCCACGAGCTCGCGGAGCTGTCG
ACGAACCCGCTGGTGAATGCGTGGTACGCCGGGGAGGATCCGACGGCGCC
GACGGAGATCGGGGACTTGTGTGAAGGGTTGTACGGGACCGGCGGCGGAG
GAGGGTATATTGGTCAAGTGATGAGGGATAACAAAGGAAGGACCTTTAAC
ATGAACGGGAGGAGAGGCAGGAGGTTTATGGTTCAGTGGGTTTGGAGTCC
CGTTCTGAAAGCTTGTGCCGGCCCTAATGCACTTGATTGATTATTTATTT
CCCAGATCTCAAAACAAGAAAATAATTCAATAGCTTGATTGAATTGTGAG
TCTTGAATTTGGTTGGAGGTGGAGGTGGTCAGTGATGGGAGTTTCTTTTT
TCTTTTCTTTTTTTCTTTTTCAATGGTTAAGTTATATAATATATAGATTT
GTAAAGAGA
back to top