DC900302

Overview
NameDC900302
Unique NameDC900302
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length624
Libraries
Library NameType
VSScdna_library
Alignments
Feature NameTypeLocationAnalysis
DC900302_ssr408 microsatellite DC900302_ssr408:408..419.
Csv1_Contig9895 contig Csv1_Contig9895:4..628. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionDC900302 VSS Citrus sinensis cDNA clone VS28651 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900302 ID=DC900302|Name=DC900302|organism=Citrus sinensis|type=EST|length=624bp
CGTACACAGCTCTTTCTCATCAACCTATTCTTCTTCTCATCCAATACTCG
TAATAACTCTCAAACAAACCAACAGGAAAATAATAAATATAATAATAAGA
AGAAGAATCAAATTTCTTTAGCAGAGGATCATCAGGAGCAATGAGTTACT
ACAATCAGAATCAGCCCCCTGTTGGTGTACCCCCTCAGCAAGGTTATCCT
CCAGAGGGATATCCGAAGGACGCTTATCCTCCACCGGGATATCCTCCTCA
GCAGGGATACCCCCCGGGTGGTGGCTATCCTCCACAACAAGGATACCCTG
CGCAGGGTGGCTACCCGCCTACTCAGTACGCTCCTCAATACGGCCAGCCT
CCCCCCCCGCAACAAAAACAAAGCGTTGGTTGCCTCGAAGGATGTTTGGC
TGCCCTGTGCTGCTGCTGCTTGCTGGATGCTTGCTTCTGATAAACAATGA
GTAGCAGCTTGATTGAAGTTTGGTACTAAGGCGAATTAAATATAATTCAA
TTCTTTAGTGTCAAATCACCTGTTTGTGACTTGTTTTTAGTTTCTCATGT
GTATTTTTTTTTTTTCTATCTTTCAAATACCCTTACTGCCGTTTATTTTC
GTTAATAAGATTTGAGACTTTTGT
back to top