DC900284

Overview
NameDC900284
Unique NameDC900284
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length747
Libraries
Library NameType
VSScdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionDC900284 VSS Citrus sinensis cDNA clone VS28631 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900284 ID=DC900284|Name=DC900284|organism=Citrus sinensis|type=EST|length=747bp
CCTCTCTCTCACTCCACCTCTATAAATTCATTTCCTTTGACTTCACAAAC
TCCTAGAGTGTTGTTTTTCCTTTTGAGACAATGGAGGTTGTGGAGACGCA
AGCCTTGTCGAACTTCGATCTCCAGTCGAGGTCTCCGTGCTCTTCTTACA
TGGCCATTCCGTCTTCGGACAACCACCCCCAACATTCGGTCATAGACGCG
CCTGGAGACGTTTGTAGTGAGTCACGTGCGGCGGTTAAGCTACAGAAGGT
CTACAGGGGTTATCGCACCCGGCGTAGGTTAGCTGATTCCGCTGTTGTTG
CTGAAGAGCTCTGGTGGCGAGCGATAGATTTTGCTCGGTTGAGCCACAGT
ACGGTGTCGTTCTTTAATTTCTCGAAGCCAGAGAGTGTTGCTTCACGATG
GAATCGGGTTACCTTAAATGCTTCCAAGGTGGGTAAGGGGCTGTCAAAAG
ACTCAAAAGCACAAAAACTGGCTTTTCAGCATTGGATTGAAGCTATTGAT
CCGCGGCATCGGTATGGGCACAATTTGCATTTCTATTATGAAGAATGGCG
TAAAACTGATGCTGGTCAACCATTTTTCTACTGGTTGGATATAGGAGATG
GCAAAGATGTTGATCTCAAAGAATGTCCAAGATCAAAGCTTCGACAACAT
TGCATCAAATATTTAGGGCCTCAAGAGAGGGAACATTATGAATACATTGN
TGTCGATGGGGAGGATTATTCACAAAAAGACTGGAGATTTTCTGGAT
back to top