DC900283

Overview
NameDC900283
Unique NameDC900283
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length818
Libraries
Library NameType
VSScdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig5650 contig Csv1_Contig5650:1..819. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionDC900283 VSS Citrus sinensis cDNA clone VS28630 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900283 ID=DC900283|Name=DC900283|organism=Citrus sinensis|type=EST|length=818bp
GCAATGACGAGTCTGGCAAGCAAAGCTTCGCAAAATCAATATCAAACCCT
AGGTCTGTTAAGACTATCATTAAACTTCCTCAAAAGCTTCAGCACTACTA
CATCAGCTTCTCCTTCAACTCCGACTCCGGCTCCGGCTTCTTCTTCGGCG
AAACCAAAACGAAGAAAGAAGAAGAACTTATTCGAGGTGGCGCAGTTTTT
ACCCAACTGGGGAGTCGGTTACCACATGGCAAAAACTCATTGGGCGAACG
TCTCTTACGAAATCACCAAGATCAATCTCTACAAGGATGGGAAACATGGA
AAGGCTTGGGGAATTGTTCATAAAGACGGCCTACCAGCCACTGACGCTCC
CAGGAAAATAAGTGGAGTTCACAAGCGCTGCTGGAGGTACATTCCCAGCT
TGTCAAAGTCAGTTGAAAGCACACCAAAAGTAACAGCACCAAAAGAAATT
GCCCCTACTGCTGAAGTTCAAGCAGCTTGATTTTTTTTTTAAATTTACAT
TTTTGGTACTGTTGCGTGACCATTCATCCTCTGTTGCCCTCCTTGTCAAT
GCCCTGTGTTTTGGGTTGCACTCTGTCCTTTAGATATGTTGACCTCTTAA
ATCATTCATTTTCTGAAGGTAGTTGATGCGTTTGTGTAACATCTATGTGG
CTTGAAACTAGACACGCTTTTAGAAAGGCACATGCAGGTCCAGAGTGAGC
AATGTAAAGCAACAGTATTGATTGAAGTTTTTTCTTCTGCTCGGAGTGAA
TTTTAGTTAGGCAAACCTATGTTTAAGGAATCTGGCAAGAAAATTCAGTT
TATTTTCCTTTTGTTTGT
back to top