DC900282

Overview
NameDC900282
Unique NameDC900282
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length459
Libraries
Library NameType
VSScdna_library
Properties
Property NameValue
Genbank descriptionDC900282 VSS Citrus sinensis cDNA clone VS28629 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900282 ID=DC900282|Name=DC900282|organism=Citrus sinensis|type=EST|length=459bp
CAGGGTTCCAAGTCCCTGTTCGGACTGCAGCATAACTTGTCAAGGGCTCC
CTAGCCACTGTGTTGATGGCAAGTGCACTTGTGGCGATACCCGGCCACTC
GATACAGCCGGCGAACCGCAACCAATAGATGCAGCCGGCGAACCGCAGCC
AATGGATGCAGCCGGCGAACCGGAGCCAATAGATGCAGCCGGCGAACCGG
AGCCAATAGATGCAGCCGGCGAACCGGAGCCAATAGATGCAGCCGGCGAA
CCGGAGCCAATAGACGCAGCCGGCGAACCGGAGCCAATAGATGCAGCCGG
CGAACCGCAACCAGTAGATGGCTAGATGCAGCCGGCGAACCGGATCTGCA
CAAAAAAAATTGAAAATTGTCTGATTATCAAAAAAATTAAATAATGTTCA
CTGGTCTTTTATCTTTGGAAGTAATGTCCGGTAACAATTAGTAAATTGGC
TCTTTCTCC
back to top