DC900277

Overview
NameDC900277
Unique NameDC900277
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length318
Libraries
Library NameType
VSScdna_library
Alignments
Feature NameTypeLocationAnalysis
DC900277_ssr212 microsatellite DC900277_ssr212:212..223.
Csv1_Contig4239 contig Csv1_Contig4239:4..320. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionDC900277 VSS Citrus sinensis cDNA clone VS28622 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900277 ID=DC900277|Name=DC900277|organism=Citrus sinensis|type=EST|length=318bp
TTACGGTTCACTAGAAGCTTTGAAGAATATGGAATCTCTTTGCGAAGGTA
AGAATGATTGGTCGGAGGGTCTCCAATTTCCACCATGTGGCAGTATCGTT
CATGATGAGATTGTGAATGAAAGTCTTGATCTTCTTGTTCCTCCACAACA
TGGAAGAAATTCCAACCACACTGGTTAAGTGCATGAAATGTCACTTTTTT
TATATTATGTTTAAATAAATAAAATGGTGGATACTGTTATAAAATCTCTT
GAGATATTCAAGAGATTTTATTTGTTTATTTACATGTACCGCGTTTTCCT
AAAAATAAAATAAATAAA
back to top