DC900269

Overview
NameDC900269
Unique NameDC900269
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length193
Libraries
Library NameType
VSScdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig11077 contig Csv1_Contig11077:249..441. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionDC900269 VSS Citrus sinensis cDNA clone VS28612 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900269 ID=DC900269|Name=DC900269|organism=Citrus sinensis|type=EST|length=193bp
ATTATCATAGCTGCAATAAGTTTAACGGAGAATGTTGTTACGCGAATGGT
AGAATAATGATCAGGCTAAAGAGGGTAGAGGTTGGAGGTCTTTGGAGTCT
CTTCTCTGGAAGAGAAATTATTTATGCCCTCATGTAATTAATTAACACAT
CATTGAATTAAGTAATGGAAATAATTCGTTTGTTATTGCCTTA
back to top