DC900263

Overview
NameDC900263
Unique NameDC900263
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length515
Libraries
Library NameType
VSScdna_library
Alignments
Feature NameTypeLocationAnalysis
DC900263_ssr460 microsatellite DC900263_ssr460:460..515.
Properties
Property NameValue
Genbank descriptionDC900263 VSS Citrus sinensis cDNA clone VS28607 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900263 ID=DC900263|Name=DC900263|organism=Citrus sinensis|type=EST|length=515bp
AAATTAAGAATTTTAATAGCACAAAAAAGATGCTACAGAAAAAAAAAGTT
TCCTCGATGTTTTCCCAATGTCACTGTGAAGAGTGCACTAAAATTTCCCG
AGTCTTTTGCAACCTTCTGGAACTTTTGTAAAAATGCTGTTAACAAGTCC
ATTGACGTGCTTTTATATGGAGTGATCTTCAGCAGGGCTCAGCAGAAAGG
TCTTCAGCTTCCCAATTTGGACTGACCATGGACATGTTTATATCCTAGAT
TCATCGGTACAATGGTGAGGGTGACTGCCACCTTTATAGGTTTGAATCCT
TTATCTGGTAGGACTGACTTGTTAATGGAACCAGGTTATAGGGTACACAA
CGGTATACTCCATGTCTGTGATGGTCCACACTTCATAGAAAGATATGGCA
TTTTCCAGATGATGCAATGCAAGTACCATGAAAGTGGCTCGTGCCGAATT
CGGCACGAGTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCT
CTCTCTCTCTCTCTC
back to top