DC900256

Overview
NameDC900256
Unique NameDC900256
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length704
Libraries
Library NameType
VSScdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Properties
Property NameValue
Genbank descriptionDC900256 VSS Citrus sinensis cDNA clone VS28296 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900256 ID=DC900256|Name=DC900256|organism=Citrus sinensis|type=EST|length=704bp
CGACGGACGACCAGTTGAGTTTGATGGGTACATGANAGTTGCTGTGGATA
CAGAGGTCTTCTACAGAGCAAAGACACGTGTGGAAACATTCTATAATTTG
ACCAAAGACTGCAAGGATGGAGTTAATACCTGCTGACCAGGTTGGGGGAT
AGCTCTTGTCGCCGTAAGCATAAATTGATCTGCATCTTTTGTTATGTTTT
AAGTCTCTTGATTCTGGCACGGAATGATAATATTGGGTTTATTTTAGGCT
CTTATTTTAAAAAAAAAAAAAAAAAAACCGAGACCCTCGTCCTCGGTGTT
GCTCCTGTCAAGATGCACTCTGAGGGGTCCGAGATGGGATTCGGAGCCGA
GGGCGGCTGCGGCTGCAAGTGTGGACCAAACTGCAAGTGCGACCCTTGTA
ACTGTTAATGAAGACTACGAGACGTGAACATGCCCCAGAATAAAGCAGCG
CTGTGAGGTCGTTTAAATTATAGTATCAATAAAAAGAACTATTTATCGTT
TGTGGTTGGCTTTGTTGGATGTCGTTTTATGAGCTTTTGTTTGTAAAATA
AAAACCAGCCATGGCTGCTTCTCCGAATCCTTAACTGGGTCTGTTGCAGA
TCCATGGCTAGTTAATTAATCATTAAGTGTCTCTGTGACTTTGTGTACGA
GCGTATCTGTTACTGCTGCTATTCTAATGGGAAGCTTCCTCTCAGACTTT
TATC
back to top