DC900249

Overview
NameDC900249
Unique NameDC900249
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length274
Libraries
Library NameType
VSScdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig8877 contig Csv1_Contig8877:280..553. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionDC900249 VSS Citrus sinensis cDNA clone VS28288 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900249 ID=DC900249|Name=DC900249|organism=Citrus sinensis|type=EST|length=274bp
CCAAATTTCAGATTCATCCCAGTTTCCTGAATCCTACATCACAAAAATTG
TACTAAATTGAATTCTTAGCCCATGCTCGATTTTCAGTTTCATGGTCATT
GTGATTATAGTAGCCTGCTTTTCTGTCCCTCTGCTCAGAGATAGTGTTGA
CATATATCGTTGTATGTATTTTTAACAGCTGTTTCCCAACTTAATTACCA
GTATCGATCTGCAGCATAGAAGAAAATATTAGATCTATGGCTTTTCGATG
GAGTTATTGAAGAATAGCTTTGTT
back to top