DC900213

Overview
NameDC900213
Unique NameDC900213
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length253
Libraries
Library NameType
VSScdna_library
Properties
Property NameValue
Genbank descriptionDC900213 VSS Citrus sinensis cDNA clone VS28249 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900213 ID=DC900213|Name=DC900213|organism=Citrus sinensis|type=EST|length=253bp
CCCCCCCCCCCCCCCCCAAAAAAAAAAAAGGACGAACAGTGAGATTCTGG
AGAAGTAGAAAGGATTAGGAAGCTGCTTTCTATTTTTTATAGTTTGCTTC
GTCATTTCCAGTTGGGATTTTAATTTATAATTTATTGTATATGCCATTGC
TGTCTTGTACGATTCTATTTATTGTGAGCGTTTGTTTCTTGGGCCTTCTT
CTGCTTTGTGTATTGAGATTGTCAGTAATAATAAGAAACGAAGACATTTC
TGT
back to top