DC900209

Overview
NameDC900209
Unique NameDC900209
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length343
Libraries
Library NameType
VSScdna_library
Properties
Property NameValue
Genbank descriptionDC900209 VSS Citrus sinensis cDNA clone VS28246 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900209 ID=DC900209|Name=DC900209|organism=Citrus sinensis|type=EST|length=343bp
GCGGCTTGTGAAAATTGCAGCAAGGGTTATTCGCAGGCCAAAAAGACTCT
ATCTAAAGCAGATGCTAAGCTGAAGGGTGGTGATTATGATAATGCTAATC
ATTTTGTGATCTTGGCTTTAAGTGATGAGTTTGTCCAAAGGTGTGAGCCA
AGTTTGGAGCCTTACAGTGAAAAGCAAGGTGTGTATGATGCCTTTTACCA
GATTAGGGTTTACGAAGAACTTACTGGAATAGCACTGGCGATCATTGATC
GATTAGCGACTTGATTTAGTTTCATTTTAAATATATATGTAACAAATCAA
TAATTTAAGATCATCATAAGAGATAAATAAAACGTTACTTATA
back to top