DC900186

Overview
NameDC900186
Unique NameDC900186
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length1055
Libraries
Library NameType
VSScdna_library
Analyses
This EST is derived from or has results from the following analyses
Analysis NameDate Performed
BLAST: Citrus ESTs to Prunus persica proteins V12010-05-10
BLAST: Citrus ESTs to Populus V2 proteins2010-05-10
BLAST: Citrus ESTs to TAIR92010-05-10
Alignments
Feature NameTypeLocationAnalysis
DC900186_ssr853 microsatellite DC900186_ssr853:853..864. BLAST: Citrus ESTs to Prunus persica proteins V1
Csv1_Contig546 contig Csv1_Contig546:17..1071. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionDC900186 VSS Citrus sinensis cDNA clone VS28219 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900186 ID=DC900186|Name=DC900186|organism=Citrus sinensis|type=EST|length=1055bp
CTGACAGAACCCTAATTCAATTCCCCAGTTATAGTCTAAACTGAGCCAAT
GTCTCGACGGGAGAGTCGTGATTCCGACTCCAGACGACACCGTTCTCGAT
TCGACCGTGAACCCAGTCCTAAGAGGTCTCGGAGGGATGGAAAACCTGTA
GCAGAGAGAGTACCCAGTAGCAATAATTTGGATAATGATCATACCCATCG
CCGTCGGCTGCAAGCTGCAGTACCACTTGAGGCTCCGTCAGTGCCTTATT
CTAAGGGTGAGAGTGGGTCTCTAGCTAAAGATTCTGACAAGAAACCTAAT
GGATTTCACGAACAAGCAAAAGGTTCTTCTGATCCAACTGAAGCTCCTCG
GTCTCAATCTTTTTTTCAGCACGATGAGCGTAGTAATGCCGGGCAAGTTG
GTAGAAGCTTCAGTCGCCGAGCTGCTGGTGAGCGTGATTGGCGGAGGGAT
TCGAGGAATCAGAAATATGAAGGAGCATCAGACAAGAAAGAATCTTATGA
TACACGGCAAAGAGATGAAAAAGCGCAAGCTAAGGGTGATGACAAGAGTG
TTTGGAGCCATGATGGATTCCACAAGTTGGAAGCTGATCTACAAGCACCT
GCCCGAAAAAGACGTGCATTTAGAGAAGAGAAGATCCCATTGGACTCTGA
AAATGCCGATAAAACAGCACTAGAGCAAGTCAACCTCAGCGCTGCTGAGC
GACCTCCATTAGGAAGTGAAAGAAGGGAGGATAGAAGCCGCAATTCCCAC
CATTCAGAGATATATGATAGACCACCTACAAGAGAGAGATTGGCAAACAG
GGAAGAATCACAGAGGGTTGGCTACCCATCAAGACAAAGGTATGGTAGTG
GAGGTGGTGGTGGTTTTGGTGATTATAGGGGTAGAGATAGATATGACCGA
AGGCAAGAGTTTCACTTGGGTGGCACTCAAGGTGACAAGTGGAAGCATGA
TCTGTTTCAGGAGGCTAACCGGAGTCCAACCCCGAAGGATGAAGAGGATC
GGATTGCCAAGTTAGAAGCACTCCTGTCTTCATAAGGAAAAATTGCTCTC
AAGAG
back to top