CN186132

Overview
NameCN186132
Unique NameCN186132
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length203
Libraries
Library NameType
Washington Navel Orange Stored Fruit Pulp cDNA Librarycdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig11152 contig Csv1_Contig11152:679..881. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionUCRCS05_0002G16_r Washington Navel Orange Stored Fruit Pulp cDNA Library Citrus sinensis cDNA clone CS_WEb0002G16, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CN186132 ID=CN186132|Name=CN186132|organism=Citrus sinensis|type=EST|length=203bp
GCGTTGATTAATCAGAGGTCAGATCGATGATCTGCTGGCTTTTCTTTATT
ATCACCATGTATTACGCACACTAGTAATGCCCAGAAAACGAACTTGTGGT
GGCGCCGTCGTATTTAGTAATTTGTACAATATTTTTATTTTTGTTCGTTT
GTTGCAGAAAATGATGGGAATTTGATTAAAGTTATGCAAAAAAAAAAAAA
AAA
back to top