DC900135

Overview
NameDC900135
Unique NameDC900135
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length450
Libraries
Library NameType
VSScdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig8281 contig Csv1_Contig8281:1241..1691. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionDC900135 VSS Citrus sinensis cDNA clone VS27V54 5, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900135 ID=DC900135|Name=DC900135|organism=Citrus sinensis|type=EST|length=450bp
GACGTGGCCGTGGTTCAAGGGGTGGATATGGTGGTAGCACGTCCAGCAGT
GCAGCAGCTCCTAAAATTGAAGACCCTGGACAATTCCCCTCCTTGGGTGG
CAAGTGACATATTAAAGAGCAGACCATGGTCCTTCCTTGTTTGGAATCCG
TTGTGATGAATTTAAGAGTCAGGTCAAAGGCTATTTAACAGGGAATTGAT
AATTTCCTGTGAAAAGGAACCATCGTTGATGTTAAAGTCTTTTGAGTGTG
AATTTTAGATATTTACCCATGTTTAAGTCTTTGACATTTATGCATACCCT
TTTTTTTTTTTTAAATTCCCCTCTTTTTTTCTGCTTTAAGTTAGGGCACA
TGGGTCATATTTATGTTTTGAACTAAGTAGTGGCATCAGTTTTGGTTTGT
ACTAGGTTATTAGGCCTTTCAAATTTGAATAAAAATTTTCTTATTTCCTG
back to top