DC900128

Overview
NameDC900128
Unique NameDC900128
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length685
Libraries
Library NameType
VSScdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig12042 contig Csv1_Contig12042:1782..2465. BLAST: Citrus Unigene V1 Contigs to Prunus persica proteins V1
Properties
Property NameValue
Genbank descriptionDC900128 VSS Citrus sinensis cDNA clone VS27V45 3, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>DC900128 ID=DC900128|Name=DC900128|organism=Citrus sinensis|type=EST|length=685bp
ATAATATTACATCACAAAGGGCGAACCGATTTCATTACACAATAAAGTCA
TTGCAAAGAGTACAGTCCATGAATAAATGAAGCCTGCAAAACCAGGGCCT
GGTGAATAAAAAACAACCCTCGGGTTGTCAAGGCAGACCATNTAACTTGC
TGCCAAGGCCAAGACCCCGTCGACACAAGGCATCAAAAATTCTGAACCGT
TAAAAGCAACGACAACAAAGTGACTCTCATGACTTTTTAATCCACCCTTT
GAGAAAAACATAGACCCAACATGTGGCATCAAAAACGTGGAACACTTGGT
AAACAGACTCGAAATTTGCAAAGACAAAAGCTTAGTCTCACCATAGACTA
TAGCTAAAACACTAGGTACGGACACCCAGTAGCACAAAACCATTAACAGC
GGAGGGAATACCCTAGAAACATAACCCAGTAGCTGTATTCTCAGGAAAAT
ATGGCCTTAAAGTGACACCCGTAATTGGGCATCAAAAAGCTGTAACAGAT
TTTCTTTCATTCGGAAACCTGCAAAAAAGGTAGAGGCCATATTCACCCTG
GAAAAAGAAACCGAGCACTTGAAGACTGAAGACCCATAGCAGATGGACCC
AAAAACTAAACAAACTGCTGCTGCTACTCACAGATGCTGACTAGGAAAAT
TCTGAGACTTCCTGATATGTTCATCCCCATCCTTT
back to top