CN185981

Overview
NameCN185981
Unique NameCN185981
TypeEST
OrganismCitrus sinensis (Sweet orange)
Sequence length723
Libraries
Library NameType
Washington Navel Orange Stored Fruit Pulp cDNA Librarycdna_library
Alignments
Feature NameTypeLocationAnalysis
Csv1_Contig2514 contig Csv1_Contig2514:1..723. Citrus sinensis Unigene version 1.0 (Csv1)
Properties
Property NameValue
Genbank descriptionUCRCS05_0002C20_r Washington Navel Orange Stored Fruit Pulp cDNA Library Citrus sinensis cDNA clone CS_WEb0002C20, mRNA sequence.
Sequences
The following sequences are available for this feature:

EST sequence

>CN185981 ID=CN185981; Name=CN185981; organism=Citrus sinensis; type=EST; length=723bp
CGTTATACACAAACTCTATTTCTGAAAGTCAAATCTGGCCTCCTATGTAG
ATGAACAAGAGCGTAAGGCTTTTTTTTTTTTTTTCTTCAGATATTATAGA
GGCTAGAAAGGGTAAAAAGAGAATAGCATGTCATGGTGGGTTCATGATAA
TTATCTCCCTGTGAAGTATAAAGCCACAAACCCATCATCAATCCTCTGAG
ATCAGACTCCAGAAATTATATAGCAAAAATATTATGTTATGTATATTTCT
GAAAAAAAAAATTGGATATTTTAATAAATCTTCTCTCTGTTCAAAACCGA
AATACGCGCACACCTTATTGCACTGCAGTGCAGCAATCATAATGTCTTCT
CGCCTCTTCCTCCCATCATTAATCCCTCACTTTCATCATGACCACTCAGT
CTTTTGCTATCTACCAACCGCACCAAAGCCACCAGCCACTTCAACAAAGA
TCGGAAGATCAGCTTGGAGGAGAAAGAAGAAATTAAGAGAAGGGTTTGTA
GACGTTGATGAAGATGGCTCCAATCAAGAAGAAGAAACCCTATCTTTCAT
TCACAGTATAGCTATTATGCGGTAATGAAGCTGACTAATTAAAGGGTTTA
ATGGTCAATCTCTCTTATCTCTTCTCTTGGGGAATCGAAGCATCATGGTC
CGATTGTTTGCTAGATCAAGCAACAAATCTAAATATATACATATATAAGA
TAATTATATGTCTATATATAATA
back to top